Warning: file(http://tymek10.nazwa.pl/statlink/ender_blogi.txt): failed to open stream: HTTP request failed! HTTP/1.1 404 Not Found in /home/hydra14/ftp/sepupulebubu.pl/media/data.php on line 27

Warning: file(http://tymek10.nazwa.pl/statlink/ender_tagi.txt): failed to open stream: HTTP request failed! HTTP/1.1 404 Not Found in /home/hydra14/ftp/sepupulebubu.pl/media/data.php on line 28
Audi prezentuje nowy model R18 e-tron quattro

Audi prezentuje nowy model R18 e-tron quattro

Strata podczas ciąży lub w okresie noworodkowym: zasady opieki z przypadkami klinicznymi i analizami

Utrata dziecka, czy to przez poronienie, poród martwego dziecka, czy śmierć po urodzeniu, jest tak ogromną stratą, jak można się było spodziewać. Każdy, kto zajmuje się opieką kobiet w ciąży i ich rodzin, może świadczyć o intensywności tych doświadczeń. Zwłaszcza w przypadku lekarzy programy szkoleniowe zwracają niewystarczającą uwagę na nauczanie spodziewanego przebiegu utraty żałoby i modelowanie umiejętności doradzania rodzinom w ż...

Więcej »

Ryzyko zachorowania na raka u potomstwa dzieci z chorobą nowotworową

Coraz większa liczba dzieci chorych na raka przeżywa i osiąga wiek rozrodczy. W Danii w latach 1983-1987 średni pięcioletni łączny wskaźnik przeżycia wynosił 64 procent dla pacjentów w wieku poniżej 20 lat, u których zdiagnozowano raka, oraz w Finlandii, w latach 1985-1989, łączny wskaźnik przeżycia wynosił 76 procent dla pacjentów w wieku poniżej 15 lat Szacowanie ryzyka nowotworów złośliwych wśród potomstwa tych pacjentów było trudne z...

Więcej »

stomatologia ursynow

Zgodnie z tym zjawiskiem u ludzi, myszy Tg-MYOCY437H eksprymują ludzką zmutowaną myocylinę w sercu i nerce na wysokich poziomach, jednak myszy te nie wykazują innych fenotypów związanych ze stresem ER (danych nie pokazano). Możliwe, że miocylina jest nieprawidłowo sfałdowana w tych tkankach; jednak te tkanki mogą lepiej radzić sobie z nieprawidłowo sfałdowanymi myocylinami w szlakach UPR. Postawiliśmy hipotezę, że istnieją specyficzne dla tkanki...

Więcej »

Sposród tych okreslen pojecia organizacji, najczesciej spotykane jest pojecie organizacji w znaczeniu czynnosciowym

Sondę wytworzono z pary komplementarnych oligonukleotydów zawierających specyficzne miejsce wiązania dla czynnika transkrypcyjnego NF-.B: 5. AGCTTGGGGACTTTCCACTAGTACG3 . i 5. AATTCGTACTAGTGGAAAGTCCCCA3 .. Oligonukleotydy zaprojektowano tak, aby po przyłączeniu DNA dwuniciowej sondy zawierały jednoniciowe 5. Końce. Sondę znakowano przez wypełnienie jednoniciowych 5. Końcami fragmentem Klenowa w obecności [32P] deoksy-ATP. Komplementarne oligo...

Więcej »
Audi prezentuje nowy model R18 e-tron quattro 751#zalecenia przed gastroskopią , #małowodzie przyczyny , #promyk świebodzice , #godzina jazdy na rolkach , #badanie atpo cena , #czerniak bezbarwnikowy jak wygląda , #mała pojemność płuc objawy , #reakcja organizmu na stres , #ból brzucha w 10 tygodniu ciąży , #uszkodzenie kręgów szyjnych ,