Skip to content

Wirus Epsteina-Barra i komórkowa ścieżka sygnałowa w chłoniakach od pacjentów z niedoborem odporności czesc 4

1 miesiąc ago

472 words

Sondę wytworzono z pary komplementarnych oligonukleotydów zawierających specyficzne miejsce wiązania dla czynnika transkrypcyjnego NF-.B: 5. AGCTTGGGGACTTTCCACTAGTACG3 . i 5. AATTCGTACTAGTGGAAAGTCCCCA3 .. Oligonukleotydy zaprojektowano tak, aby po przyłączeniu DNA dwuniciowej sondy zawierały jednoniciowe 5. Końce. Sondę znakowano przez wypełnienie jednoniciowych 5. Końcami fragmentem Klenowa w obecności [32P] deoksy-ATP. Komplementarne oligonukleotydy wygrzewano przez ogrzewanie do 95 ° C przez pięć minut, następnie pozwolono na ochłodzenie na stole. Znakowaną sondę wyizolowano, a reakcje wiązania i elektroforezy przeprowadzono w sposób opisany wcześniej. Autoradiografię przeprowadzono na wysuszonym żelu. Specyficzność przesuniętego pasma określono przez porównanie z odpowiednimi pozytywnymi i negatywnymi kontrolami i przez użycie nadmiaru zimnego oligonukleotydu, aby konkurować z znakowaną radioaktywnie sondą, pozostawiając w ten sposób brak widocznego przesuniętego pasma na autoradiografie. Amplifikacja DNA
Para starterów oligonukleotydowych 5. GTTCGCGTTGCTAGGCCACC3. I 5. AGGACCACTTTATACCAGGG3. Użyto do amplifikacji DNA, która flankuje część sekwencji powtórzeń BamW genu jądrowego antygenu EBV, otrzymując produkt o wielkości 100 pz. DNA amplifikowano przez 30 do 40 rund w termocyklerze DNA (model 2400, Perkin-Elmer Cetus, Norwalk, Conn. Lub Rapidcycler, Idaho Technology, Boise, Idaho) zgodnie z zaleceniami producenta. W przypadku termocyklera Perkin-Elmer amplifikacja polegała na denaturacji przez 60 sekund w temperaturze 94 ° C, wyżarzaniu startera przez 90 sekund w temperaturze 56 ° C i wydłużeniu przez 90 sekund w temperaturze 72 ° C; w przypadku Rapidcycler amplifikacja polegała na denaturacji przez 5 sekund w temperaturze 94 ° C, wygrzewaniu przez 10 sekund w temperaturze 56 ° C i wydłużeniu przez 15 sekund w temperaturze 72 ° C. Produkty amplifikacji rozdzielano za pomocą elektroforezy w żelu agarozowym (NuSieve, FMC Bioproducts, Rockland, Me.) I analizowano przez barwienie bromkiem etydyny pod kątem odpowiedniego pasma DNA. Porównano również linie kontrolne EBV-dodatnie i ujemne względem EBV.
Wyniki
Tabela 1. Tabela 1. Charakterystyka pacjentów z post-przeszczepową chorobą limfoproliferacyjną i pacjentami z chłoniakiem nieziarniczym związanym z AIDS. Wyniki morfologiczne, klonalność, charakterystykę cytogenetyczną i wzór ekspresji genów EBV w próbkach nowotworu od ośmiu pacjentów z chorobą limfoproliferacyjną po transplantacji22 i dwóch pacjentów z chłoniakiem nieziarniczym związanym z AIDS przedstawiono w Tabeli 1. Dwie z 10 próbek – zarówno u pacjentów z chorobami limfoproliferacyjnymi po przeszczepieniu – były ujemne pod względem EBV. Inne próbki były dodatnie pod względem EBV i eksprymowały białko LMP1 na mikroskopie immunofluorescencyjnym i immunoblottingu zachodniego (dane nie pokazane). Wszystkie trzy próbki endemicznego chłoniaka Burkitta były EBV-dodatnie w wyniku reakcji łańcuchowej polimerazy, ale w żadnym z nich nie wykrywano białka LMP1 za pomocą mikroskopii immunofluorescencyjnej lub immunoblotingu zachodniego. W tych trzech chłoniakach rearanżacje genu MYC wykryto metodą Southern blotting (niepublikowane obserwacje).
Ryc. 2. Rycina 2. Lokalizacja utajonego białka błonowego czynnikiem związanym z receptorem TNF w próbkach nowotworowych od pacjenta z chorobą limfoproliferacyjną po przeszczepie (× 1000)
[przypisy: bromazepam, dekstran, wdrożenia magento ]
[więcej w: hiperamonemia, zapalenie migdałków objawy, zapalenie nerwu twarzowego ]

0 thoughts on “Wirus Epsteina-Barra i komórkowa ścieżka sygnałowa w chłoniakach od pacjentów z niedoborem odporności czesc 4”