Skip to content

szernera warszawa dojazd

2 miesiące ago

510 words

Bardzo istotny w leczeniu choroby z wieloma autoreaktywnościami jest silny efekt terapeutyczny na EAE MP4, chimerycznego białka fuzyjnego, obejmującego całą długą izoformę MBP (21,5 kDa MBP) i hydrofilowe domeny PLP (. PLP) (16). Tolerogenne podawanie w pełni zniesionego MP4 EAE aktywnie indukowanego przez PLP139-151, jak również EAE adoptywnie przenoszone z kombinacją encefalitogennych komórek T specyficznych wobec MBP i PLP u myszy SJL / J. Przeciwnie, ani 21,5 kDa MBP, ani wstrzyknięty osobno nie potrójnie PLP nie wykazywały takiego dramatycznego wpływu na bierny EAE, w którym pośredniczą połączone populacje komórek T (16). Podsumowując, badania te sugerują, że celowanie w większość odpowiednich komórek T może być wymagane dla optymalnej skuteczności specyficznego układu immunologicznego w chorobie związanej z patogenną reaktywnością komórek T wobec więcej niż jednego antygenu / epitopu. Poniżej przedstawiamy badania pilotażowe dotyczące podejścia multitarnego do specyficznej immunomodulacji złożonego EAE związanego z wieloma chorobotwórczymi autoreaktywnościami. Syntetyczny gen, oznaczony syntetyczny ludzki gen autoantygenu z wieloma celami, powiązany z EAE (shMultiTAG / E), został zaprojektowany do kodowania wyłącznie encefalitogennych i istotnych dla choroby epitopów MBP, PLP i MOG. Efekt immunomodulacyjny jego produktu białkowego, ludzkiego autoantygenu autoantygenu (hmTAP), został przetestowany na aktywnym i pasywnym EAE indukowanym przez odpowiedzi limfocytów T na zdefiniowane epitopy, jak również na kompleksowy EAE pasywnie przenoszony przez wieloreaktywne komórki T. Metody Myszy. Samice myszy C3H.SW i SJL / J zakupiono w The Jackson Laboratory (Bar Harbor, Maine, USA) lub otrzymano od kolonii Weizmann Institute of Science; (C3H.SW x SJL / J) Myszy F1 hodowano w Instytucie Zwierząt Instytutu Weizmanna. Wszystkie myszy miały 2. 3 miesiące, gdy były używane w doświadczeniach. Syntetyczne oligonukleotydy związane z wytwarzaniem, amplifikacją i klonowaniem DNA shTAG kodującego epitopy MOG, MBP lub PLP. Dla każdego z shTAG, oligonukleotydy o długości 60-70-nukleotydów, które reprezentują kodony reszt aminokwasowych wybranych epitopów wyrównanych sekwencyjnie i które są komplementarne w ich 5. i / lub 3. końce do sąsiednich oligonukleotydów przez nałożenie 15. 18 nukleotydów, zostały zsyntetyzowane przez Weizmann Institute of Science Synthesis Unit. Odpowiednie oligonukleotydy obejmują specyficzne miejsca restrykcyjne endonukleaz, aby umożliwić klonowanie lub ligację w ramie sąsiednim shTAG. Syntetyczne oligonukleotydy stosowane do wytwarzania i amplifikacji DNA shTAG / MOG są następujące: shMOG Ia: 5a-CATGGTATGGCTAGCGGGCAGTTCAGAGTAGATAGGACCAAGACACCCT ATCCGGGCTCTGGTC-3 .; shMOG Ib: 5. -CATGGTATGGCTAGCGGGCAGTTCAGAGTGATAGGA-3 .; shMOG II: (wsteczny) 5a -CTCCATGCCTGTAGCGCGACATGGCAATTCCACTTCATCCCCG ACCAGAGCCCGGATAGG-3 .; shMOG III: 5C-CGCGCTACAGGCATGGAGGTGGGGTGGTACCGCCCCCCCTTCTCTAGG GTGGTTCATCTCTACAGAAAT-3 .; shMOG IV: (wsteczny) 5. -TTTCAGCAGCTCTGTCCGGCCCCGATATTCAGGATCTTG GTCCTTGCCATTTCTGTAGAGATGAAC-3 .; shMOG V: 5-CGGACAGAGCTGCTGAAAGATGCTATTGGTGAGGGAAAGGTGACTCTCA GGATCCGGAATGTAAGG-3 .; shMOG VIa: (odwrotna) 5-CAGAGAGATCTAGGTGAAACCTCCTTCATCTGAGAACCTTACAT TCCGGATCCT-3 .; shMOG VIb: (wsteczny) 5-CAGAGAGATCTGGGTGAAACC-3 .. Miejsce NheI w shMOG Ia i Ib oraz miejsce BglII w shMOG VIa i VIb są podkreślone. Syntetyczne oligonukleotydy do wytwarzania i amplifikacji DNA shTAG / MBP są następujące: shMBP Ia: 5a -GAAGATCTCTGGAGGCGGTTCCCAGAGGCACGGATCCAAG-3 .; shMBP Ib: 5 -GAAGATCTCTGGAGGCGGT-3 .; shMBP Ic: 5a-TTGGACGCTAGCTCCCAGAGGCACGGATCCAAGTACCTG-3 .; shMBP II: (rewersyjny) 5 (3-GAGGAACCCATGCCTGGCATGGTCCATGGTACTTGCTGTGGCCAGGTACTTGGATCCGTGCCTCTG-3 .; shMBP III: 5 (3-GCCAGGCATGGCTTCCTCCCAAGGCACAGAGACACGGGCATCCTTGACTCCATCGGGCGCTTCTTTGGC-3; shMBP IV: (wsteczny) 5a-AATGTTCTTGAAGAAGTGGACTACGGGGTTTTCACCCCTGTCAC CGCCAAAGAAGCGCCCGAT-3 .; shMBP V: 5-CACTTCTTCAAGAACATTGTGACGCCTCGCACACCACCCCCGTCGCAGG GAAAGGGG-3 .; shMBP VI: 5a-AATTTTGGAAAGCGTGCCCTGGGCATCGACTCCCTTCCCCTTTCCCTGC GACGG-3 .; shMBP VII: (wsteczny) 5 (3-GGCACGCTTTCCAAAATTTTTAAGCTGGGAGGAAGAGATAGTC GCTCT-3; shMBP VIIIa: (odwrotna) 5a-ACCTCTCGAGCCAGCCATGGGTGATCCAGAGCGACTATCTCTTC CTCC-3 .; shMBP VIIIb (odwrotny) 5a-ACCACTCGAGCCAGCCATGGGTGATCCAGA-3 .; shMBP VIIIc: (wsteczny) 5a-ACCACTCGAGCTAAGCCATGGGTGATCCAGA-3.
[więcej w: zapalenie migdałków objawy, zapalenie nerwu twarzowego, zespół aspergera test ]

0 thoughts on “szernera warszawa dojazd”