Skip to content
2 miesiące ago

589 words

Badanie to stanowi podstawę do zbadania roli stresu ER u pacjentów z JPOK oraz oceny stosowania chaperonów chemicznych w łagodzeniu POAG. Istnieje kilka powszechnie stosowanych modeli jaskry z gryzoniami, z których każdy ma swoje mocne i słabe strony (29, 30). Naturalnie występujący mysi model jaskry DBA / 2J rozwija się w postaci zmian o charakterze jaskry śluzowej w przednim odcinku, co powoduje podwyższenie IOP, po którym następuje progresywne uszkodzenie nerwu wzrokowego i utrata RGC (31). Istnieje również wiele indukowanych modeli nadciśnienia ocznego, które powodują uszkodzenie nerwu wzrokowego i RGC, w tym wstrzyknięcie hipertonicznej soli fizjologicznej do żył nadtwardówkowych u szczurów (32), fotokoagulację laserową szlaku odpływu wody u szczurów i myszy (33. 35), kauteryzacja naczyń pozagałkowych u szczurów (36) i myszy (37) oraz wstrzyknięcie mikrokulek w celu zamknięcia ścieżki odpływu u szczurów i myszy (38). Obecny model Tg-MYOCY437H opiera się na naszej poprzedniej pracy wykazującej, że śródoczne wstrzyknięcie mysich oczu specyficznymi adenowirusowymi wektorami ekspresyjnymi Myoc podniosło IOP (10). Nasz nowy model wykorzystuje zmutowany gen ludzkiej jaskry do naśladowania wielu cech POAG, w tym: uszkodzenia TM z otwartym kątem komory przedniej, podwyższonym IOP, postępującym nerwem wzrokowym i uszkodzeniem RGC i utratą funkcji wzrokowej. Inaczej niż w modelach ostrych, uszkodzenia związane z ciśnieniem pojawiają się progresywnie w ciągu miesięcy. Dodatkowo, uszkodzenie jest synchroniczne, z podobnymi wzrostami IOP i uszkodzeniami w określonym wieku występującymi w obu oczach (intraindividual) i wśród miotów (osobnik). Wykazaliśmy również, że interwencja terapeutyczna zarówno wczesna, jak i późna w procesie chorobowym może chronić przed uszkodzeniem jaskrowym. Sposoby Wytwarzanie transgenicznych myszy Tg-MYOCY437H. Ludzki gen MYOC amplifikowano z biblioteki cDNA ludzkiego marathona (Clontech) i klonowano do ssaczego wektora ekspresyjnego pCS2 +. CDNA zmodyfikowano w celu wprowadzenia mutacji Tyr437His przy użyciu zestawu do mutagenezy QuikChange (Stratagene). Sekwencję konstruktu zweryfikowano za pomocą sekwencjonowania DNA Sangera. Kasetę ekspresyjną zawierającą promotor CMV, cDNA MYOC i poliA SV40 wycięto enzymami restrykcyjnymi NotI i SalI i wstrzyknięto do przedjądrza świeżo zapłodnionych oocytów C57BL / 6J x SJL / J (B6SJL; The Jackson Laboratory). Twórca został połączony z myszami C57BL / 6J i eksperymentami przeprowadzonymi z F2 i późniejszymi generacjami krzyżowo skrzyżowanych myszy B6SJL; Tg (CMV-MYOCY437H) / Vcs (w skrócie jako Tg-MYOCY437H). Myszy genotypowano za pomocą PCR stosując startery swoiste dla ludzkiego MYOC. Startery były następujące: hMYOC-Tr-Fr: CGTGCCTAATGGGAGGTCTAT; hMYOC-Tr-Rr: CTGGTCCAAGGTCAATTGGT. Inbredowe myszy SJL / J niosą mutacje Pde6brd1 i Tyrc. Aby uniknąć potencjalnie zakłócającego wpływu tych mutacji w Tg-MYOCY437H, wszystkie myszy użyte w doświadczeniach zostały genotypowane dla mutacji Pde6brd1. W doświadczeniach stosowano myszy, które były WT lub heterozygotyczne pod względem Pde6brd1 i pigmentowane. Hodowla myszy. Myszy przechowywano i hodowano w ośrodku dla zwierząt badawczych University of Iowa. Myszy utrzymywano na diecie 4% tłuszczu NIH 31 zapewnionej ad libitum i trzymano w klatkach zawierających suchą pościel (SoftZorb Enrichment Blend; Northeastern Products). Środowisko utrzymywano w temperaturze 21 ° C z cyklem 12 godzin światła / 12 godzin ciemności. Wszystkie zabiegi na zwierzętach przeprowadzone w tym badaniu były zgodne z oświadczeniem ARVO w sprawie wykorzystania zwierząt w badaniach okulistycznych i wzroku i zostały zatwierdzone przez Komitet ds. Pielęgnacji i Używania Zwierząt Uniwersytetu w Iowa. Pomiary IOP. IOP zmierzono za pomocą tonometru odbicia, jak opisano wcześniej (39). Myszy znieczulono stosując 2,5% izofluran plus 100% tlenu
[podobne: olx tomaszów lub, zapalenie przyzębia, zespół aspergera test ]

0 thoughts on “rozpoznanie adhd”

  1. [..] Oznaczono ponizsze tresci z artykulu oryginalnego: błąd lekarski odszkodowanie[…]