Skip to content

Hiperinsulinizm i hiperamonemia u niemowląt z regulacyjnymi mutacjami genu dehydrogenazy glutaminianowej cd

3 miesiące ago

474 words

W przypadku eksonu 11, starterem do przodu był TGTAGTGTCTGTTAGAGAGAG, a starterem do tyłu był ACACACATGTCACGCACTTAC. W przypadku egzonu 12 przednim starterem był ACAGGGACACAAAGCAGGTC, a starterem do reakcji do tyłu był ACAGTCTGGCGGCTGAGATAG. Mutagenezę ukierunkowaną wykorzystano do skonstruowania plazmidu pcDNA3 (Invitrogen) zdolnego do ekspresji w komórkach COS-7 mutacji zidentyfikowanej u Pacjenta 1: zmiana z histydyny na tyrozynę w pozycji 454 enzymu (His454Tyr). Pełnej długości prawidłowy cDNA ludzkiej dehydrogenazy glutaminianowej uzyskano dzięki uprzejmości dr Roberta Colman (Department of Chemistry, University of Delaware). Odpowiednie podstawienie nukleozydem tymidyny do cytozyny w pozycji 1532 wprowadzono w dwóch rundach nakładających się PCR z parą wewnętrznych primerów zawierających zmutowaną zasadę. Po potwierdzeniu, że orientacja i sekwencja były prawidłowe, zmutowaną dehydrogenazę glutaminianową pcDNA3 His454Tyr transfekowano do komórek COS-7 za pomocą Lipofectin (BRL) i klony wyselekcjonowano za pomocą G418 (Geneticin, BRL). Podwielokrotności komórek opornych na G418 hodowano na 96-studzienkowej płytce, a subklony testowano w celu określenia, czy mają one zwiększoną ekspresję dehydrogenazy glutaminianowej i czy zmieniano wrażliwość enzymu na GTP. Komórki transfekowane samym wektorem pcDNA3 zastosowano jako kontrole. Test t-Studenta wykorzystano do porównania wyników tych badań z różnymi grupami badanych.
Wyniki
Enzymatyczna aktywność dehydrogenazy glutaminianowej
Tabela 1. Tabela 1. Aktywność i reakcja allosteryczna dehydrogenazy glutaminianowej w limfoblastach od dzieci ze sporadycznym lub rodzinnym zespołem hiperinsulinii-hiperletemii, ich pokrewnymi krewnymi i podmiotami normalnymi. Aktywność i allosteryczne odpowiedzi dehydrogenazy glutaminianowej w limfoblastach od pacjentów są pokazane w Tabeli 1. Aktywność enzymu u pacjentów z sporadycznymi przypadkami hiperinsulinemii – zespołu hiperamonemii nie była hamowana przez GTP, jak pokazuje fakt, że połowa -maksymalne stężenie hamujące (IC50) tego efektora było prawie cztery razy większe niż u zdrowych osobników. Aktywność enzymatyczna u pacjentów z klinicznie łagodniejszymi przypadkami rodzinnymi była również mniej wrażliwa na hamowanie przez GTP, ale IC50 była tylko dwukrotnie wyższa od wartości normalnej.
Podstawowa i maksymalna aktywność dehydrogenazy glutaminianowej stymulowanej ADP była podobna u pacjentów ze sporadyczną hiperinsulinią – hiperamonemią iu osób zdrowych. U pacjentów z rodzinnymi przypadkami podstawowa aktywność enzymatyczna wynosiła 38% wartości prawidłowej, chociaż maksymalnie stymulowana aktywność dehydrogenazy glutaminianowej była tylko nieznacznie mniejsza niż normalnie (P = 0,07). Czułość na stymulację ADP była podobna w trzech grupach. Wzorzec różnic pomiędzy trzema grupami był podobny po dializie homogenatów limfoblastów, co wyklucza możliwość, że nieprawidłowości były spowodowane przez wiązanie cząsteczek efektorowych z enzymem (dane nie pokazane). Wyniki te są zgodne z obecnością wrodzonych nieprawidłowości w dehydrogenazie glutaminianowej w obu grupach pacjentów. Dehydrogenaza glutaminianowa limfoblastu pochodząca od nietkniętych rodziców i rodzeństwa obu grup pacjentów miała prawidłową odpowiedź na GTP
[podobne: flexagen, suprasorb, celiprolol ]
[podobne: ziarnica zlosliwa, ziarnica złośliwa i chłoniaki nieziarnicze, olx tomaszów lub ]

0 thoughts on “Hiperinsulinizm i hiperamonemia u niemowląt z regulacyjnymi mutacjami genu dehydrogenazy glutaminianowej cd”

  1. [..] Oznaczono ponizsze tresci z artykulu oryginalnego: chirurgiczne usuwanie zębów ósemek[…]